mouse anti human receptor for age rage monoclonal antibody  (R&D Systems)

Journal:

Article Title: Glycated LDL increases monocyte CC chemokine receptor 2 expression and monocyte chemoattractant protein-1-mediated chemotaxis

doi: 10.1016/j.atherosclerosis.2007.10.035

Figure Lengend Snippet: AGE-LDL increased CCR2 mRNA level in human macrophages. A) The CCR2 mRNA level was quantified by RT-PCR following 6 hours of treatment of macrophages with either LDL or AGE-LDL. B) Cells were preincubated with 50 μg/mL of either anti-RAGE or isotype control antibodies for 1h before stimulation. Data are normalized to the respective expression levels in LDL-treated cells, and shown as mean ± SEM; n=6. The experiments were performed three times for each donor.

Article Snippet: An anti-human Receptor for AGE (RAGE) mouse monoclonal antibody and its IgG2b isotype control (R&D systems) served to test the involvement of RAGE by blocking receptor-ligand interactions. table ft1 table-wrap mode="anchored" t5 caption a7 Forward Reverse CCR2 TCCATTCTCTCAGGCTTGC TGAGCATCAAGGACATCTG GAPDH TGAAGGTCGGAGTCAACGGATTTGGTCGTA ATCTCGCTCCTGGAAGATGGTGATGGGATT Open in a separate window CC chemokine receptor 2 (CCR2); glyceraldehyde 3-phosphate dehydrogenase (GAPDH) caption a8 PCR primers

Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing

Journal:

Article Title: Glycated LDL increases monocyte CC chemokine receptor 2 expression and monocyte chemoattractant protein-1-mediated chemotaxis

doi: 10.1016/j.atherosclerosis.2007.10.035

Figure Lengend Snippet: AGE-LDL increased CCR2 mRNA level in human macrophages. A) The CCR2 mRNA level was quantified by RT-PCR following 6 hours of treatment of macrophages with either LDL or AGE-LDL. B) Cells were preincubated with 50 μg/mL of either anti-RAGE or isotype control antibodies for 1h before stimulation. Data are normalized to the respective expression levels in LDL-treated cells, and shown as mean ± SEM; n=6. The experiments were performed three times for each donor.

Article Snippet: An anti-human Receptor for AGE (RAGE) mouse monoclonal antibody and its IgG2b isotype control (R&D systems) served to test the involvement of RAGE by blocking receptor-ligand interactions. table ft1 table-wrap mode="anchored" t5 caption a7 Forward Reverse CCR2 TCCATTCTCTCAGGCTTGC TGAGCATCAAGGACATCTG GAPDH TGAAGGTCGGAGTCAACGGATTTGGTCGTA ATCTCGCTCCTGGAAGATGGTGATGGGATT Open in a separate window CC chemokine receptor 2 (CCR2); glyceraldehyde 3-phosphate dehydrogenase (GAPDH) caption a8 PCR primers Western blot analysis Cell extracts (20-30 μg total protein/lane) were separated by standard SDS-PAGE under reducing conditions and blotted to polyvinylidene difluoride membranes (PerkinElmer Life Sciences, Boston, MA).

Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing